Ingeniero de Sistemas y Full-Stack Dev freelance desde 2017. +8 años en PHP (Laravel), Python (Django, Odoo), Node.js, Vue, React. AWS, Docker y DevOps.
AI is analyzing your overall score…
Identifying your key strengths…
Evaluating your skill match against the job requirements…
Assessing your cultural and operational fit
Desweb
Frontend Developer
June 21, 2026 – Present
Plaython
May 7, 2025 – May 21, 2025
Plaython: plataforma de matchmaking para retos y eventos de programación. Conecta profesionales de distintas especialidades, forma equipos balanceados y coordina actividades. Su algoritmo inteligente optimiza la asignación de roles y la planificación de tareas, asegurando colaboraciones exitosas en hackathons y codeathons.
View Projectcompress-video-GUI
May 2, 2025 – June 14, 2025
A Python/Tkinter desktop app for compressing MP4 videos using FFmpeg. Configure CRF, H.264 presets, audio bitrate and CPU threads, and monitor real-time logs in a responsive GUI.
View Projectsets_last_unique_string_finder
May 2, 2025 – May 2, 2025
`Last Unique String Finder` es una pequeña utilidad escrita en Python que permite identificar la última cadena única en una lista de elementos (`list[str]`). Si no existe ninguna cadena única (todas se repiten) o la lista está vacía, la función devuelve una cadena vacía ''
View Projectinventory-management
April 3, 2025 – April 3, 2025
inventory-management — GitHub repository
View Projecte-reservation
July 3, 2019 – August 26, 2024
Course of Hibernate y Java Spring in platzi.com
View ProjectrepeatedDNASequences
June 25, 2019 – June 25, 2019
All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T. In research, it can be useful to identify repeated sequences within DNA. Write a function to find all the 10-letter sequences (substrings) that occur more than once in a DNA molecule s, and return them in lexicographical order. These sequences can overlap. Example For s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT", the output should be repeatedDNASequences(s) = ["AAAAACCCCC", "CCCCCAAAAA"]. Input/Output [execution time limit] 4 seconds (php) [input] string s Guaranteed constraints: 0 ≤ s.length ≤ 5000. [output] array.string An array containing all of the potential 10-letter sequences that occur more than once in s.
View ProjectCultural Fit Analysis
The candidate's personal projects show a diverse interest in various technologies (Python, PHP, Java, JavaScript, Vue, HTML, CSS). While this indicates a broad technical curiosity, the focus on backend/scripting projects (Python, PHP) is more prominent than dedicated frontend projects, which might require a stronger alignment with a pure 'Frontend Developer' role. The 'Plaython' and 'inventory-management' projects are the most relevant to the target role, showcasing TypeScript, JavaScript, Vue, and CSS.
Soft Skills & Operational Fit
Insufficient data to assess soft skills and operational fit. The psychometric test score is 0, providing no insights.